90
|
Promega
stem-loop primer reverse transcription reaction Stem Loop Primer Reverse Transcription Reaction, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop primer reverse transcription reaction/product/Promega Average 90 stars, based on 1 article reviews
stem-loop primer reverse transcription reaction - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Promega
stem-loop reverse transcript primer and m-mlv reverse transcriptase Stem Loop Reverse Transcript Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop reverse transcript primer and m-mlv reverse transcriptase/product/Promega Average 90 stars, based on 1 article reviews
stem-loop reverse transcript primer and m-mlv reverse transcriptase - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Beijing Genomics Institute Shenzhen
stem-loop reverse transcription primer Stem Loop Reverse Transcription Primer, supplied by Beijing Genomics Institute Shenzhen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop reverse transcription primer/product/Beijing Genomics Institute Shenzhen Average 90 stars, based on 1 article reviews
stem-loop reverse transcription primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Sangon Biotech
downstream and reverse transcription primers of stem-loop method Downstream And Reverse Transcription Primers Of Stem Loop Method, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/downstream and reverse transcription primers of stem-loop method/product/Sangon Biotech Average 90 stars, based on 1 article reviews
downstream and reverse transcription primers of stem-loop method - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Ribobio co
primers for stem-loop reverse transcription pcr (rt-pcr) and quantitative pcr (qpcr) Primers For Stem Loop Reverse Transcription Pcr (Rt Pcr) And Quantitative Pcr (Qpcr), supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers for stem-loop reverse transcription pcr (rt-pcr) and quantitative pcr (qpcr)/product/Ribobio co Average 90 stars, based on 1 article reviews
primers for stem-loop reverse transcription pcr (rt-pcr) and quantitative pcr (qpcr) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
MiRXES Inc
modified stemloop reverse transcription primer pools Modified Stemloop Reverse Transcription Primer Pools, supplied by MiRXES Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/modified stemloop reverse transcription primer pools/product/MiRXES Inc Average 90 stars, based on 1 article reviews
modified stemloop reverse transcription primer pools - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Ribobio co
speci c stem-loop reverse transcription primer set Speci C Stem Loop Reverse Transcription Primer Set, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/speci c stem-loop reverse transcription primer set/product/Ribobio co Average 90 stars, based on 1 article reviews
speci c stem-loop reverse transcription primer set - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Bioteke Corporation
stem-loop reverse transcription primer (sequence: 5′- gttggctctggtgcagggtccgaggtattcgca ccagagccaactcaaca-3′) Stem Loop Reverse Transcription Primer (Sequence: 5′ Gttggctctggtgcagggtccgaggtattcgca Ccagagccaactcaaca 3′), supplied by Bioteke Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop reverse transcription primer (sequence: 5′- gttggctctggtgcagggtccgaggtattcgca ccagagccaactcaaca-3′)/product/Bioteke Corporation Average 90 stars, based on 1 article reviews
stem-loop reverse transcription primer (sequence: 5′- gttggctctggtgcagggtccgaggtattcgca ccagagccaactcaaca-3′) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Ribobio co
customized kits containing the stem-loop reverse transcription primer and mir-specific molecular beacon probe Customized Kits Containing The Stem Loop Reverse Transcription Primer And Mir Specific Molecular Beacon Probe, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/customized kits containing the stem-loop reverse transcription primer and mir-specific molecular beacon probe/product/Ribobio co Average 90 stars, based on 1 article reviews
customized kits containing the stem-loop reverse transcription primer and mir-specific molecular beacon probe - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Ribobio co
stem-loop reverse transcription primers and pcr primers for the genes of interest Stem Loop Reverse Transcription Primers And Pcr Primers For The Genes Of Interest, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop reverse transcription primers and pcr primers for the genes of interest/product/Ribobio co Average 90 stars, based on 1 article reviews
stem-loop reverse transcription primers and pcr primers for the genes of interest - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Promega
stem-loop reverse transcript primer Stem Loop Reverse Transcript Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop reverse transcript primer/product/Promega Average 90 stars, based on 1 article reviews
stem-loop reverse transcript primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Ribobio co
gene-specific stem-loop primers for reverse transcription Gene Specific Stem Loop Primers For Reverse Transcription, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene-specific stem-loop primers for reverse transcription/product/Ribobio co Average 90 stars, based on 1 article reviews
gene-specific stem-loop primers for reverse transcription - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |